BTomato9024 BTomato9024
  • 03-07-2018
  • Biology
contestada

Are organisms in the same family also in the same class

Respuesta :

AnabelaLancome AnabelaLancome
  • 03-07-2018
I think they are not
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what is the geometric mean between 6 and 20?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
what is the percent change from 70 to 56?
Please help with Algebra 1
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D