jamyadunn35 jamyadunn35
  • 03-12-2018
  • English
contestada

should gun permit be allowed in high school?

Respuesta :

Аноним Аноним
  • 03-12-2018

NOO!!! Guns should not be permitted in school or on school grounds. In some states, yeah guns are allowed in some schools are the country but it just depends on the state but still, guns shouldn't be allowed no matter the age.

Answer Link
dev458
dev458 dev458
  • 03-12-2018
No guns should not be allowed in high school for many reasons. Reason number 1 is it can put many lives in danger. It can also make people super uncomfortable and we want schools to be a safe place for kids
Answer Link

Otras preguntas

Step by step directions Square root for 480
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
in what area of Europe were the majority of warsaw pact countries
A vehicle is only 15% efficient. What happened to the other 85%?
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
What would be the most likely effect of one company buying a competitor?
Please help me with this two step math problem! THANK YOU !!!!!!!!
Do you think then solid can undergo convection
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5