jazzy3849 jazzy3849
  • 02-07-2019
  • Mathematics
contestada

if the ratio of boys to girls in a class is 5-13 what is the ratio of girls to all the students in the class

Respuesta :

bevisliu7 bevisliu7
  • 02-07-2019

Answer:

supposing there are only 18 students, Im guessing the ratio would be 12-18?

Step-by-step explanation:

Answer Link

Otras preguntas

Round 46.895 to the nearest tenth
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
How to change 3 7/8 into an improper fraction
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
what rule does static electricity follow