hannahjames8 hannahjames8

03-03-2020
Social Studies

contestada

If Russia launches a satellite into orbit around Jupiter, which nation then owns the satellite?

Respuesta :

cafa1988 cafa1988

11-03-2020

Answer:

Russia

Explanation:

Any country that launches satellite owns it.
In universe there is no territorial division, according to which some area belongs to some state.
The satellite that are launched from Earth belong to the country that launched them.

Answer Link

Otras preguntas

what's the ph of citric acid

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If a family has three children, what is the probability that the family has at least one girl?

Name the five transport mechanisms of the cell:

Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.

A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma

The wealth and prosperity of mali and songhai were dependent on controlling the trade in

"which band was led by guitarist peter buck and vocalist michael stipe?"

For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle