testbot194 testbot194
  • 03-04-2020
  • History
contestada

How were Christians significant in the development of the Puritan Religion

Respuesta :

hamzaafzal012
hamzaafzal012 hamzaafzal012
  • 03-04-2020

Answer:

The Puritans believed that God had formed a unique covenant, or agreement, with them. They believed that God expected them to live according to the Scriptures, to reform the Anglican Church, and to set a good example that would cause those who had remained in England to change their sinful ways.

Explanation:

Answer Link

Otras preguntas

How do you put allele in a sentence
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
Fossils are most commonly found in which type of rock?
is a centimeter one tenth or one hundredth or a meter
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5