ashaw2652323
ashaw2652323 ashaw2652323
  • 03-04-2020
  • Mathematics
contestada

What is the value of X

What is the value of X class=

Respuesta :

agarwalmeena200
agarwalmeena200 agarwalmeena200
  • 03-04-2020

Answer:

3

Step-by-step explanation:

if you look at the line E there is the number 6 and the number 5 if you add those up you get 11.

Since it is a circle the diameter is the same so 11 - 8 gives you the value of x.

Answer Link

Otras preguntas

When the term F.O.B. shipping point is used, title passes when the
According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr
Does the increase in blood glucose levels increase the viscosity of the blood
A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie
If an employee gets potentially infectious material splashed in his eye, what should he do?
NEED HELP ASAPPPPPPP
Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re
what does a light year measure
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Exponential Equation WITHOUT CALCULATOR