rnh2007
rnh2007 rnh2007
  • 02-07-2020
  • Mathematics
contestada

Plzzz help! I will give brainiest and 100 points! 4x2 = 0 (the 2 is an exponent)

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 02-07-2020

Answer:

x =0

Step-by-step explanation:

4x^2 =0

Divide by 4

x^2 = 0

Take the square root

sqrt(x^2) = sqrt(0)

x = 0

Answer Link
mhanifa
mhanifa mhanifa
  • 02-07-2020

Answer:

x=0

Step-by-step explanation:

4x²=0

x²=0

x=√0

x=0

Answer Link

Otras preguntas

Find the area of a kite with diagonals 10 & 5
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2
The truman administration tried to help europe recover from the devastation of world war ii with the _____.
Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors
why did the church oppose the heliocentric theory
Social ___ is a large category of people who share many similar levels of wealth , power, and prestige
what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat