luisdelacruz12338 luisdelacruz12338

03-09-2020
Computers and Technology

contestada

HELP AS SOON AS YOU CAN!!! what word best describes an appropriate study area?

Respuesta :

Wilhitejayden11 Wilhitejayden11

03-09-2020

Answer:

Quiet

Explanation:

Really anywhere thats quiet you can just sit down and study. For example a library

Answer Link

Otras preguntas

Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A guaranteed protection against vague laws is known as which of the following?

Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)

An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos

HELP ASAP!! Which United States' president, in addition to Eisenhower, believed the federal government should play a smaller role in the economy? A) Ford B) Ca

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.

How did the Bataan Death March gets its name