joyfullmonkey joyfullmonkey

02-12-2020
Health

contestada

What is the food plate?

A) A guide for healthy eating

B) A special food test

C) A type of recipe

D) No answer text provided.

Respuesta :

marlenerodriguez1201 marlenerodriguez1201

02-12-2020

A) A guide for healthy eating

Answer Link

jamaribrowning16 jamaribrowning16

02-12-2020

Answer: D i dont see the right answer so it is D

Explanation:

Answer Link

Otras preguntas

Which country is the world’s largest producer of wheat? USA China Russia France

what is 3(2x-4)=5x+2

how many moles of NaCl are equivalent to 15.6g NaCl

Choose all that apply. Melinda finds that she does not like taking risks with her money. Which of the following would you recommend for her? Collectibles stock

The term used when an organism is studied in its natural environment is

The octet rule states that, in chemical compounds, atoms tend to have ____. the electron configuration of a noble gas more protons than electrons eight electron

What is the elapsed time

It takes 10 workers 24 hours to do a job. Fill in the chart.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.