kc8zk5gab5
kc8zk5gab5
03-02-2021
Mathematics
contestada
Help with this one very confused
Respuesta :
hernay62stu
hernay62stu
03-02-2021
Answer: 250m2
Step-by-step explanation: You multiply 10 x 5 x 5 = 250
Answer Link
VER TODAS LAS RESPUESTAS ( 82+ )
Otras preguntas
Which sentence best describes how a business letter should be written? A business letter should have its body aligned to the right margin of the page. A busines
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.
hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C
Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,
"which band was led by guitarist peter buck and vocalist michael stipe?"
Can I get some help with these questions thank you
Which of these sentences is punctuated correctly? Although the concert doesn't start for over an hour; most of the fans have already arrived at the concert hal
Phillip advised his clients they needed to paint their master bedroom before showing the property. the walls of this room were 11' high. the wall lengths were 1
One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
