nayelixmendoza nayelixmendoza
  • 02-03-2021
  • Biology
contestada

If a species 2N (diploid) cell equals 46 chromosomes, how many chromosomes are there in a egg cell?

Respuesta :

robertslily946
robertslily946 robertslily946
  • 02-03-2021

ask a tutor if no one answers !!

Answer Link

Otras preguntas

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
Why did the American public mostly oppose joining the League of Nations after WWI?
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
What is the range of function of y-1=(x+3)^2
The Panama Canal connects what two bodies of water?
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
What are some methods used by Mussolini to rise to power?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5