Jkayla343
Jkayla343 Jkayla343
  • 04-01-2015
  • Mathematics
contestada

$0.90 for 3/4 pound of bananas

Respuesta :

kuromimi123 kuromimi123
  • 04-01-2015
If 3/4 lb of bananas cost $0.90, then 1 lb of bananas cost $1.20.
Answer Link
derpeyboy237 derpeyboy237
  • 04-01-2015
1 lb $1.20 because if 3/4 is $0.90 then for each fourth it costs $0.30
Answer Link

Otras preguntas

In which system of government would states function independently of each other?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What statement best describes a republic?
What kind of problems did increased urbanization cause? During time of industrial revolution
i need help with this question
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4