stepsis12 stepsis12
  • 04-01-2022
  • Physics
contestada

Explain mantle convection.

Respuesta :

kingkam4 kingkam4
  • 04-01-2022

Answer:

Mantle convection is the very slow creeping motion of Earth's solid silicate mantle caused by convection currents carrying heat from the interior to the planet's surface. The Earth's surface lithosphere rides atop the asthenosphere and the two form the components of the upper mantle.

Explanation:

Answer Link

Otras preguntas

what played a great role in the kansan nebraska act
Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Ashya wants to focus on the diagnosis and treatment of psychological disorders and other problematic patterns of behavior. what area of psychology should she wo
What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis
If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?
It takes 10 workers 24 hours to do a job. Fill in the chart.
Please help I'm trying to figure out 4-15 but i don't know how to.