rileyjohnson11 rileyjohnson11
  • 04-05-2022
  • Mathematics
contestada

i need an equation with a variable on each side that equals 15

Respuesta :

quandaledinglefan123
quandaledinglefan123 quandaledinglefan123
  • 04-05-2022

Answer:

2x + 5 = 3x

Step-by-step explanation:
In this equation, x = 5 and both sides equate to 15. Hope this helped!

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
21. Expository Writing Describe the forces that tended to unify Americans in the early 1800s as well as some of the important points of disagreement. Your essay
A bicycle tire is spinning clockwise at 2.50 rad/s. During a time period Dt 5 1.25 s, the tire is stopped and spun in the oppo- site (counterclockwise) directio
Name the three type of islands in Oceania and how they are created
An actively contracting muscle will cause local temperature to rise and will produce acidic molecules. Warmth and lower pH cause the oxygen-hemoglobin saturatio
Which African country faces serious skin aside in 1994 during which almost million people were killed
List 3 antonyms for the word commissary.
What is the hook in the story “why read Shakespeare”
For the data set below which of the following measures is greatest? 3,3,4,5,6,8,16,20
The city that is about 1,000 km from Berlin is