samhernandez1 samhernandez1
  • 01-05-2017
  • Business
contestada

what is the first step to take when trying to solve a problem?

Respuesta :

Аноним Аноним
  • 01-05-2017
Know what the problem is?
Answer Link
AminaArdekani
AminaArdekani AminaArdekani
  • 01-05-2017
List all the things that you know and the thing you don't, in order to understand what you are trying to solve.

Hope this helps :)

Answer Link

Otras preguntas

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
How do you put allele in a sentence
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
What kind of problems did increased urbanization cause? During time of industrial revolution
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
how can you write 0.45 as fraction and a percentage ,please show work
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
does radiation need a phase of matter to travel with?